Logo-ajmb

Submitted: 29 Apr 2019
Accepted: 12 May 2019
First published online: 25 Jun 2019
EndNote EndNote

(Enw Format - Win & Mac)

BibTeX BibTeX

(Bib Format - Win & Mac)

Bookends Bookends

(Ris Format - Mac only)

EasyBib EasyBib

(Ris Format - Win & Mac)

Medlars Medlars

(Txt Format - Win & Mac)

Mendeley Web Mendeley Web
Mendeley Mendeley

(Ris Format - Win & Mac)

Papers Papers

(Ris Format - Win & Mac)

ProCite ProCite

(Ris Format - Win & Mac)

Reference Manager Reference Manager

(Ris Format - Win only)

Refworks Refworks

(Refworks Format - Win & Mac)

Zotero Zotero

(Ris Format - FireFox Plugin)

Abstract View: 3232
PDF Download: 1546
Full Text View: 417
Avicenna Journal of Medical Biochemistry. 7(1):16-20. doi: 10.34172/ajmb.2019.04

Research Article

The Expression of Antioxidant Genes and Cytotoxicity of Biosynthesized Cerium Oxide Nanoparticles Against Hepatic Carcinoma Cell Line

Ali Es-haghi 1, * ORCID logo, Fatemeh Javadi 1, Mohammad Ehsan Taghavizadeh Yazdi 2, Mohammad Sadegh Amiri 3

Author information:
1Department of Biology, Mashhad Branch, Islamic Azad University, Mashhad, Iran
2Medical Toxicology Research Center, School of Medicine, Mashhad University of Medical Sciences, Mashhad, Iran
3Department of Biology, Payame Noor University, Tehran, Iran

*Corresponding author: Ali Es-haghi (PhD), Department of Biology, Mashhad Branch, Islamic Azad University, Mashhad, Iran. Email: eshaghi5510@mshdiau.ac.ir; ashaghi@gmail.com

Abstract

Background: Drug resistance due to genetic variations renders many therapeutic methods such as surgery, radiotherapy, chemotherapy, and hormone therapy unsuccessful in eradicating cancerous cells. Nowadays, application of nanoparticles (NPs) has been promising in destroying cancerous cells without side effects on normal cells.

Objectives: This study aimed to investigate the antioxidant and anticancer effects of biosynthesized cerium oxide nanoparticles (CeO2 -NPs) on a hepatic carcinoma cell line.

Methods: MTT assay was used to determine the cytotoxicity of CeO2 -NPs in concentrations of 0, 15.6, 31.2, 62.5, 125, and 250 μg/mL after 24, 48, and 72 hours of incubation. Moreover, the expression levels of catalase (CAT) and superoxide dismutase (SOD) (the antioxidant genes) were investigated at different concentrations of CeO2 -NPs using real-time polymerase chain reaction (PCR).

Results: Our results showed a significant toxicity of the synthesized NPs against the cancerous liver cells. The IC50 calculated for CeO2 -NPs was 500 μg/mL at 24 hours of incubation. In addition, the expression levels of CAT and SOD significantly (P<0.05) increased upon the treatment of cells with CeO2 -NPs (500 µg /mL) compared to the untreated cells.

Conclusion: Considering the minimal effects of the biosynthesized CeO2 -NPs on normal cells and on the other hand their considerable toxicity against hepatic cancer cells, these NPs could be utilized in medicine and in the development of new drugs for cancer cells.

Keywords: Cerium oxide nanoparticles, Antioxidant gene experssionion, HepG2, Ceratonia silique

Copyright and License Information

© 2019 The Author(s); Published by Hamadan University of Medical Sciences.
This is an open-access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/4.0), which permits unrestricted use, distribution, and reproduction in any medium provided the original work is properly cited.

Background

In recent years, green chemistry methods for synthesis of nanoparticles (NPs) have become a favorite subject in nanoscience (1-3). Nanoparticle synthesis through physical and chemical methods has limitations such as toxic solvents and the remnants (4,5). Therefore, green synthesis methods using plant extracts could be beneficial in obviating such limitations (6,7). Living organisms such as plants, algae, molds, yeasts, and bacteria can be used for synthesizing NPs (8). Likewise, various physical and chemical methods have been applied in producing cerium oxide nanoparticles (CeO2-NPs) (5).

Free radicals and reactive oxygen species (ROS) significantly affect the biological systems in medicine (9). Oxidative stress participates in the pathogenesis of various diseases such as diabetes, cancer, Alzheimer’s disease, and blindness (10). Therefore, herbs containing high levels of antioxidants can beneficially protect biological systems against these agents and improve human health (11). Free radicals are natural metabolic products which cause cellular damages, dysregulate cellular proliferation, destabilize biological molecules, and interfere with normal functions of various cells. Antioxidants neutralize detrimental free radicals and minimize their cellular damages (12,13). On the other hand, nanomedicine is the science of applying NPs (particles between 1-100 nm in size) to the diagnosis and treatment of human diseases (14). In recent years, the use of NPs as carrier systems for target drugs toward cancerous cells has made significant progress (15). CeO2-NPs have been extensively applied in different fields of medicine (16,17). Cerium oxide (CeO2) is a potent antioxidant that effectively scavenges ROS and can be used as a potential anticancer agent. Furthermore, synthesized CeO2-NPs show antioxidative properties; in this respect, they have been suggested as potential new cancer therapeutics (18). In addition, synthesized CeO2-NPs can be utilized as drug carriers in cancer targeted therapy (19). They have also had anti-tumor activities against cancerous cells in vitro while protecting normal cells by antioxidant properties (20). Hepatocellular carcinoma derived from hepatocytes is one of the most common malignancies worldwide. It is characterized by its high incidence in hepatitis B virus-associated cirrhotic liver disease and other risk factors (21). Several studies have shown that extract of Ceratonia siliqua shows antibacterial, antifungal, and antidiabetic properties; thus in this work, the biomedical effects of NPs were investigated (22,23).

The aim of this study was to evaluate the cytotoxicity, antioxidant, and gene expression regulation effects of CeO2-NPs synthetized using C. siliqua extract on a hepatic cell line.


Materials and Methods

Chemicals and Reagents

The PCR Master Mix, SYBR green PCR master mix, RNeasy Mini Kit, and cDNA Synthesis Kit were purchased from Qiagen GmbH, Hilden, Germany. The other reagents not mentioned here were supplied from Merck (Germany).

Extract Preparation and Synthesis of Cerium Oxide Nanoparticles

In order to provide the aqueous extract, 10 g of dried C. siliqua leaf powder was added to the 100 mL distilledwater and stirred for 24 hours. For the biosynthesis of CeO2-NPs, 8.68 g salt of Ce (NO3)3.6H2O was allowed to react with 200 mL of aqueous C. siliqua leaf extract. In the next step, the CeO2–NPs were dried at 80°C for 6 hours, and eventually the purified green-synthesized CeO2-NPs were generated by heating at 400°C for 2 hours and brownish pellets were prepared. Cells were obtained from Bu-Ali Institute of Mashhad, Iran.

MTT Assay

Cell toxicity of NPs was investigated by the MTT assay. In Brief, HepG2 cells were seeded at a density of 10 000 cells/well in a 96-well plate. Then, the plates were incubated at 37°C for 24 hours. Different concentrations of NPs (i.e., 0, 15.6, 31.2, 62.5, 125, and 250 μg/mL) were inoculated into the grown cells that contained 100 µL of medium. During this period, after each day of incubation, 20 μL of 5 mg/mL MTT dissolved in PBS was added to each well. At the end of incubation, the medium was discarded and formazan crystals which were shaped by MTT metabolism were liquefied and dissolved through the inclusion of 100 μL of DMSO. Afterwards, the plates were shaken for 5 minutes and then the optical absorbance was measured at 590 nm.

Antioxidant Gene Expression Assay

The expressions of CAT and SOD genes were determined in the HUVEC normal cell line treated with NPs. The cells were cultured in RMPI medium at 5×103 cells/mL in a 6-well plate and incubated with different concentrations of NPs including 0, 125, 250, and 500 µg/mL for 24 hours. At the end of incubation, the cells were washed with phosphate-buffered saline (PBS, 0.1 M, pH 7.2) twice and scraped. All the real-time polymerase chain reaction (PCR) amplifications were done in triplicate. Table 1 shows primer characteristics.


Table 1. The Characteristics of Primers Used for the Antioxidant Gene Expression Analysis
Sequence Gene Tm (°C) Annealing Temperature ( ° C)
Forward 5´- AAGGCCGTGTGCGTGCTGAA-3´ SOD 64 59
Reverse 5´- CAAGTCTCCAACATGCCTCT-3´ SOD 60
Forward 5´- TTTGGCTACTTTGAGGTCAC-3´ CAT 58 55
Reverse 5´- TCCCCATTTGCATTAACCAG-3´ CAT 58
Forward 5´- TGCTGGTGCTGAGTATGTCG -3´ GAPDH 60 57
Reverse 5´- GCATGTCAGATCCACAACGG -3´ GAPDH 62

RNA Extraction

RNA was extracted from the cells after 48 hours of incubation with NPs. The extraction was done according to the kit procedure. Briefly, 1 mL of the ice-cold RNX-plus solution was added to homogenized cells and mixed by vortexing. Afterward, 200 μL of chloroform was added to the mixture and centrifuged at 12 000× g for 15 minutes at 4°C. An equal volume of isopropyl alcohol was then added to the aqueous phase and centrifuged. In the next step, 1 mL of 75% ethanol was added to the supernatant and centrifuged. The concentrations of extracted RNA were calculated using NanoDrop UV-Vis spectrophotometer and their purity was determined by gel electrophoresis on 1% agarose gel.

cDNA Synthesis

cDNA was synthesized from extracted RNA according to the manufacturer’s instructions (Fermentas Kit). The mixture was incubated in the thermal cycler and the program was set as: one cycle at 37°C for 15 minutes, one cycle at 85°C for 5 seconds, and one cycle at 4°C for 5 minutes. Samples without RT enzymes were used for detecting contamination in the samples.

Real-Time Polymerase Chain Reaction

To assess the expression of CAT and SOD genes, SYBR green-based real-time PCR (Qiagen Rotor-Gene Q, Hilden, Germany) was used. Amplification conditions were set as: initial denaturation at 95°C for 2 minutes, followed by 30 cycles of denaturation at 95°C for 15 seconds, annealing at 56.4°C for 20 seconds, and extension at 72°C for 30 seconds. The fluorescence of SYBR green signal from 65°C to 95°C was used to obtain melting curves. Double-distilled water was used as negative control.

Statistical Analysis

All data were analyzed by SPSS software using ANOVA test. The significance was confirmed by Duncan’s multiple range test. P value less than 0.05 was applied as the standard for a statistically significant difference. All experiments were carried out in triplicate and the findings were expressed as mean values ± standard deviation (mean ± SD).


Results

In this study, the cytotoxicity of CeO2-NPs synthesized from C. siliqua extract was investigated against HepG2 hepatocellular carcinoma cells. CeO2-NPs were morphologically spherical with the average size of 22 nm. The size range of the NPs varied from 13 to 30 nm. As shown in Figure 1, CeO2-NPs showed dose- and time-dependent cytotoxicity against the cancerous cells. The IC50 doses of CeO2-NPs were obtained 500 μg/mL, 300 μg/mL, and 250 μg/mL at 24, 48, and 72 hours of incubation, respectively (Figure 1). CeO2-NPs showed minimal toxicity against normal cells at the concentration of 1000 μg/mL (Figure 2).

ajmb-7-16-g001
Figure 1.

Cytotoxic Activity of CeO2-NPson the HepG2 Cell Line.

Note. Results are reported as the mean ± SD (n=3) (**P < 0.01, ***P < 0.001).


ajmb-7-16-g002
Figure 2.

Cytotoxic Activity of CeO2-NPs on HUVEC Cell Line.

Note. Results are presented as the mean ± SD (n=3) (**P < 0.01, ***P < 0.001).


Gene Expression of Catalase and Superoxide Dismutase Using Real-time PCR

The expression levels of CAT and SOD genes increased in normal cells exposed to different concentrations (125 to 500 μg/mL) of the synthesized CeO2-NPs (Figure 3 a, b). The expression level of CAT gene significantly increased (P < 0.001) upon treatment with 250 and 500 µg/mL of CeO2-NPs compared to the untreated control cells. Only at 500 µg/mL concentration of CeO2-NPs, the expression level of SOD gene was significantly (P< 0.05) increased compared to the untreated control cells. These changes prove the antioxidant properties of the CeO2-NPs.

ajmb-7-16-g003
Figure 3.

(a) The Expression Analysis of CAT Gene in HUVEC Normal Cells Upon Treatment With 0, 125, 250, and 500 µg/mL of CeO2-NPs for 24 hours. Note. *P < 0.05 and **P < 0.01 demonstrate significant differences in comparison to the control cells (0). (b) The Expression Analysis of SOD Gene in HUVEC Normal Cells Upon Treatment With 0, 125, 250, and 500 µg/mL of CeO2-NPs for 24 hours. Note. *P < 0.05 demonstrates a significant difference in comparison to the control cells (0).



Discussion

Plants have functional biochemistry groups in their structure which act as reducing agents in synthesis of NPs (24-26). In this study, the biological effects of biosynthesized NPs were investigated. Regarding the vast biological and anticancer properties of nanomaterials, CeO2-NPs have been evaluated as anticancer agents in various studies (27,28). Cytotoxicity against cancer cells is an important feature of anticancer drugs (20,29). Furthermore, antioxidant capabilities of CeO2-NPs can prevent cancer development, further suggesting these materials as potential anticancer therapeutics (30). We here synthesized CeO2-NPs and investigated their potential anticancer activities against HepG2 hepatocellular carcinoma cell line. CeO2-NPs represent minimal toxicity against normal tissues. Synthesized by green methods, they have negligible side effects on normal cells. In the present study, the antioxidant effects of the synthesized CeO2-NPs were shown. Oxidative stress increases the production of malondialdehyde and lactate dehydrogenase, which are markers of lipid oxidation and cell membrane damage (31-33). Our results indicated that CeO2-NPs synthesized from C. siliqua extract have remarkable antioxidant activities. This is in accordance with another study showing antioxidant properties of CeO2 in male rats (34). CeO2-NPs are bio-compatible and less toxic (35). Moreover, they may be considered ecofriendly and may not pose noteworthy environmental risks, in contrast to those compounds used for the chemical reduction method (36). The combination of cerium NPs with other metals may increase the anticancer effects of these NPs. In our survey, we observed that the anticancer activities of CeO2-NPswere significantly enhanced with Ni doping which was found to be strongly correlated with the level of ROS production (37). We also demonstrated the cytotoxic effects of the synthesized CeO2-NPs against HepG2 hepatocellular carcinoma cell line. The cytotoxic effects of NPs depend on the dose and time of incubation, as well. Further studies are needed to divulge other biological activities of these NPs against normal and cancerous cells.


Conclusion

In the present study, the biological effects of biosynthesized CeO2-NPs were investigated. The synthesized NPs revealed antioxidant and cytotoxic properties against HepG2 hepatocellular carcinoma cell line. Therefore, these NPs can be valuable therapeutics in treating fatal diseases such as cancer.


Authors’ Contributions

Ali Es-haghi management and coordination responsibility for the research activity planning, Fatemeh Javadi: performing the experiments, Mohammad Ehsan Taghavizadeh Yazdi: writing the initial draft and statistical analysis.


Conflict of Interest Disclosures

The authors declare no potential conflicts of interest relevant to this article.


Acknowledgments

We would like to express our sincere thanks to the Faculty of Science at Islamic Azad University, Mashhad Branch, for the provided chemicals and laboratory facilities.


References

  1. Duan H, Wang D, Li Y. Green chemistry for nanoparticle synthesis. Chem Soc Rev 2015; 44(16):5778-92. doi: 10.1039/c4cs00363b [Crossref] [ Google Scholar]
  2. Hamidi A, Taghavizadeh Yazdi ME, Amiri MS, Hosseini HA, Darroudi M. Biological synthesis of silver nanoparticles in Tribulus terrestris L extract and evaluation of their photocatalyst, antibacterial, and cytotoxicity effects. Res Chem Intermed 2019; 45(5):2915-25. doi: 10.1007/s11164-019-03770-y [Crossref] [ Google Scholar]
  3. Taghavizadeh Yazdi ME, Hamidi A, Amiri MS, Kazemi Oskuee R, Hosseini HA, Hashemzadeh A. Eco-friendly and plant-based synthesis of silver nanoparticles using Allium giganteum and investigation of its bactericidal, cytotoxicity, and photocatalytic effects. Mater Technol 2019; 34(8):490-7. doi: 10.1080/10667857.2019.1583408 [Crossref] [ Google Scholar]
  4. Ali A, Zafar H, Zia M, Ul Haq I, Phull AR, Ali JS. Synthesis, characterization, applications, and challenges of iron oxide nanoparticles. Nanotechnol Sci Appl 2016; 9:49-67. doi: 10.2147/nsa.s99986 [Crossref] [ Google Scholar]
  5. Taghavizadeh Yazdi ME, Khara J, Sadeghnia HR, Esmaeilzadeh Bahabadi S, Darroudi M. Biosynthesis, characterization, and antibacterial activity of silver nanoparticles using Rheum turkestanicum shoots extract. Res Chem Intermed 2018; 44(2):1325-34. doi: 10.1007/s11164-017-3169-z [Crossref] [ Google Scholar]
  6. Parveen K, Banse V, Ledwani L. Green synthesis of nanoparticles: their advantages and disadvantages. AIP Conf Proc 2016; 1724(1):020048. doi: 10.1063/1.4945168 [Crossref] [ Google Scholar]
  7. Taghavizadeh Yazdi ME, Khara J, Housaindokht MR, Sadeghnia HR, Esmaeilzadeh Bahabadi S, Amiri MS. Role of Ribes khorasanicum in the biosynthesis of silver nanoparticles and their antibacterial properties. IET Nanobiotechnol 2018; 13(2):189-92. doi: 10.1049/iet-nbt.2018.5215 [Crossref] [ Google Scholar]
  8. Gajbhiye M, Kesharwani J, Ingle A, Gade A, Rai M. Fungus-mediated synthesis of silver nanoparticles and their activity against pathogenic fungi in combination with fluconazole. Nanomedicine 2009; 5(4):382-6. doi: 10.1016/j.nano.2009.06.005 [Crossref] [ Google Scholar]
  9. Halliwell B. Reactive oxygen species in living systems: source, biochemistry, and role in human disease. Am J Med 1991; 91(3c):14S-22S. doi: 10.1016/0002-9343(91)90279-7 [Crossref] [ Google Scholar]
  10. Brieger K, Schiavone S, Miller FJ Jr, Krause KH. Reactive oxygen species: from health to disease. Swiss Med Wkly 2012; 142:w13659. doi: 10.4414/smw.2012.13659 [Crossref] [ Google Scholar]
  11. Sen S, Chakraborty R. The Role of Antioxidants in Human Health. In: Andreescu S, Hepel M, eds. Oxidative Stress: Diagnostics, Prevention, and Therapy. Washington, DC: American Chemical Society; 2011. p. 1-37. 10.1021/bk-2011-1883.ch001
  12. Lobo V, Patil A, Phatak A, Chandra N. Free radicals, antioxidants and functional foods: Impact on human health. Pharmacogn Rev 2010; 4(8):118-26. doi: 10.4103/0973-7847.70902 [Crossref] [ Google Scholar]
  13. Sen S, Chakraborty R, Sridhar C, Reddy YSR, De B. Free radicals, antioxidants, diseases and phytomedicines: current status and future prospect. Int J Pharm Sci Rev Res 2010; 3(1):91-100. [ Google Scholar]
  14. Nikalje AP. Nanotechnology and its applications in medicine. Med Chem 2015; 5(2):81-9. doi: 10.4172/2161-0444.1000247 [Crossref] [ Google Scholar]
  15. Brannon-Peppas L, Blanchette JO. Nanoparticle and targeted systems for cancer therapy. Adv Drug Deliv Rev 2004; 56(11):1649-59. doi: 10.1016/j.addr.2004.02.014 [Crossref] [ Google Scholar]
  16. Celardo I, Pedersen JZ, Traversa E, Ghibelli L. Pharmacological potential of cerium oxide nanoparticles. Nanoscale 2011; 3(4):1411-20. doi: 10.1039/c0nr00875c [Crossref] [ Google Scholar]
  17. Xu C, Qu X. Cerium oxide nanoparticle: a remarkably versatile rare earth nanomaterial for biological applications. NPG Asia Mater 2014; 6(3):e90. doi: 10.1038/am.2013.88 [Crossref] [ Google Scholar]
  18. Giri S, Karakoti A, Graham RP, Maguire JL, Reilly CM, Seal S. Nanoceria: a rare-earth nanoparticle as a novel anti-angiogenic therapeutic agent in ovarian cancer. PLoS One 2013; 8(1):e54578. doi: 10.1371/journal.pone.0054578 [Crossref] [ Google Scholar]
  19. Parveen S, Misra R, Sahoo SK. Nanoparticles: a boon to drug delivery, therapeutics, diagnostics and imaging. Nanomedicine 2012; 8(2):147-66. doi: 10.1016/j.nano.2011.05.016 [Crossref] [ Google Scholar]
  20. Vinardell MP, Mitjans M. Antitumor activities of metal oxide nanoparticles. Nanomaterials (Basel) 2015; 5(2):1004-21. doi: 10.3390/nano5021004 [Crossref] [ Google Scholar]
  21. Sakinah SA, Handayani ST, Hawariah LP. Zerumbone induced apoptosis in liver cancer cells via modulation of Bax/Bcl-2 ratio. Cancer Cell Int 2007; 7:4. doi: 10.1186/1475-2867-7-4 [Crossref] [ Google Scholar]
  22. Hamza R, Al-Seeni MN. Effect of using gamma-irradiated mixture extract of carob and roselle in diabetic rats. Int J Pharma Bio Sci 2015; 6(1):B951-B60. [ Google Scholar]
  23. Javadi F, Taghavizadeh Yazdi ME, Baghani M, Es-Haghi A. Biosynthesis, characterization of cerium oxide nanoparticles using Ceratonia siliqua and evaluation of antioxidant and cytotoxicity activities. Mater Res Express 2019; 6(6):065408. doi: 10.1088/2053-1591/ab08ff [Crossref] [ Google Scholar]
  24. Taghavizadeh Yazdi ME, Khara J, Housaindokht MR, Sadeghnia HR, Esmaeilzadeh Bahabadi S, Amiri MS. Biocomponents and antioxidant activity of Ribes khorasanicum. Int J Basic Sci Med 2018; 3(3):99-103. doi: 10.15171/ijbsm.2018.18 [Crossref] [ Google Scholar]
  25. Taghavizadeh Yazdi ME, Modarres M, Amiri MS, Darroudi M. Phyto-synthesis of silver nanoparticles using aerial extract of Salvia leriifolia Benth and evaluation of their antibacterial and photo-catalytic properties. Res Chem Intermed 2019; 45(3):1105-16. doi: 10.1007/s11164-018-3666-8 [Crossref] [ Google Scholar]
  26. Taghavizadeh Yazdi ME, Amiri MS, Hosseini HA, Kazemi Oskuee R, Mosawee H, Pakravanan K. Plant-based synthesis of silver nanoparticles in Handelia trichophylla and their biological activities. Bull Mater Sci 2019; 42(4):155. doi: 10.1007/s12034-019-1855-8 [Crossref] [ Google Scholar]
  27. Wu G, Zhang Z, Chen X, Yu Q, Ma X, Liu L. Chemosensitization effect of cerium oxide nanosheets by suppressing drug detoxification and efflux. Ecotoxicol Environ Saf 2019; 167:301-8. doi: 10.1016/j.ecoenv.2018.10.013 [Crossref] [ Google Scholar]
  28. Nourmohammadi E, Khoshdel-Sarkarizi H, Nedaeinia R, Sadeghnia HR, Hasanzadeh L, Darroudi M. Evaluation of anticancer effects of cerium oxide nanoparticles on mouse fibrosarcoma cell line. J Cell Physiol 2019; 234(4):4987-96. doi: 10.1002/jcp.27303 [Crossref] [ Google Scholar]
  29. Mukherjee S, Patra CR. Therapeutic application of anti-angiogenic nanomaterials in cancers. Nanoscale 2016; 8(25):12444-70. doi: 10.1039/c5nr07887c [Crossref] [ Google Scholar]
  30. Pešić M, Podolski-Renić A, Stojković S, Matović B, Zmejkoski D, Kojić V. Anti-cancer effects of cerium oxide nanoparticles and its intracellular redox activity. Chem Biol Interact 2015; 232:85-93. doi: 10.1016/j.cbi.2015.03.013 [Crossref] [ Google Scholar]
  31. Pár A, Róth E, Rumi G Jr, Kovács Z, Nemes J, Mózsik G. [Oxidative stress and antioxidant defense in alcoholic liver disease and chronic hepatitis C]. Orv Hetil 2000; 141(30):1655-9. [ Google Scholar]
  32. Cavas L, Tarhan L. Effects of vitamin-mineral supplementation on cardiac marker and radical scavenging enzymes, and MDA levels in young swimmers. Int J Sport Nutr Exerc Metab 2004; 14(2):133-46. doi: 10.1123/ijsnem.14.2.133 [Crossref] [ Google Scholar]
  33. Marjani A, Moradi A, Ghourcaie AB. Alterations in plasma lipid peroxidation and erythrocyte superoxide dismutase and glutathione peroxidase enzyme activities during storage of blood. Asian J Biochem 2007; 2(2):118-23. doi: 10.3923/ajb.2007.118.123 [Crossref] [ Google Scholar]
  34. Hirst SM, Karakoti A, Singh S, Self W, Tyler R, Seal S. Bio-distribution and in vivo antioxidant effects of cerium oxide nanoparticles in mice. Environ Toxicol 2013; 28(2):107-18. doi: 10.1002/tox.20704 [Crossref] [ Google Scholar]
  35. Khan S, Ansari AA, Rolfo C, Coelho A, Abdulla M, Al-Khayal K. Evaluation of in vitro cytotoxicity, biocompatibility, and changes in the expression of apoptosis regulatory proteins induced by cerium oxide nanocrystals. Sci Technol Adv Mater 2017; 18(1):364-73. doi: 10.1080/14686996.2017.1319731 [Crossref] [ Google Scholar]
  36. Chen L, McCrate JM, Lee JC, Li H. The role of surface charge on the uptake and biocompatibility of hydroxyapatite nanoparticles with osteoblast cells. Nanotechnology 2011; 22(10):105708. doi: 10.1088/0957-4484/22/10/105708 [Crossref] [ Google Scholar]
  37. Abbas F, Jan T, Iqbal J, Ahmad I, Naqvi MSH, Malik M. Facile synthesis of ferromagnetic Ni doped CeO2 nanoparticles with enhanced anticancer activity. Appl Surf Scie 2015; 357:931-6. doi: 10.1016/j.apsusc.2015.08.229 [Crossref] [ Google Scholar]